WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00040784 Gene Name  Cbr-adpr-1
Sequence Name  ? CBG22162 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Tetratricopeptide-like helical domain superfamily; WD domain, G-beta repeat; WD40 repeat; WD40/YVTN repeat-like-containing domain superfamily; and WD40-repeat-containing domain superfamily. Is an ortholog of C. elegans adpr-1. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG22162.1 CBG22162.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG22162 CBG22162   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-adpr-1, TCAAGGAATCTGGAAAGCCGACGATCACATTCTGAACATCGTCCAACCGCATCCAGAAGC, WBGene00040784   Expr1063973 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG22161, GATGGGAGCTGGAGGGAAGAGTCAAAAGGCTATGTACACTGGAACAGGAATCTACTCTTT, WBGene00040783   Expr1069469 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region