WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00183634 Gene Name  Cjp-phf-14.2
Sequence Name  ? CJA28060 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: PHD-zinc-finger like domain; PHD-finger; Zinc finger, PHD-finger; Zinc finger, FYVE/PHD-type; Zinc finger, RING/FYVE/PHD-type; and Zinc finger, PHD-type. Is an ortholog of C. elegans phf-14. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA28060.1 CJA28060.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA28060 CJA28060   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA28060, GGATGTTTGACCCCTCCGTTGACAAAATTGCCAAAAAGGAACAATTGCGGGTGGATTTGC, WBGene00183634   Expr1075079 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA16371, CGAATAGCTGGCTACACGACACGTTTGAAGAGGTTTCCAATGCAGAGAGGAAGAAGACAC, WBGene00135575   Expr1091278 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region