WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00120251 Gene Name  CJA01047
Sequence Name  ? CJA01047 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: NAD(P)-binding domain superfamily; Short-chain dehydrogenase/reductase SDR; Enoyl-(Acyl carrier protein) reductase; and short chain dehydrogenase. Is an ortholog of C. elegans C06B8.3; F12E12.11; and F26D2.15. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA01047a.1 CJA01047a.1   [unknown]
Transcript:CJA01047b.1 CJA01047b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA01047b CJA01047b   [unknown]
CDS:CJA01047a CJA01047a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA01047, AAATCTTTCCTCTTATATCATCGGACAATCGATTGTGGCTGATGGAGGTACCTCCTTGAT, WBGene00120251   Expr1073449 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region