WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00127190 Gene Name  CJA07986
Sequence Name  ? CJA07986 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Cap-specific mRNA (nucleoside-2-O-)-methyltransferase 1 and WASH complex subunit 7, C-terminal. Is an ortholog of C. elegans cmtr-1. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA07986.1 CJA07986.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA07986 CJA07986   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA07986, CGCACTCCATACGGTCCAGAGAAAATTATCAACTACCCAGAAGCCTTTGAAGGAAATCCG, WBGene00127190   Expr1074675 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA09065, ACACGTTCTCAACGGATGGGACTCGTTTTTTGCGATGAACTGGTTTGAAAGTTATACAAT, WBGene00128269   Expr1091765 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region