WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00135966 Gene Name  CJA16762
Sequence Name  ? CJA16762 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domain: Uncharacterized protein T19C3.2-like. Is an ortholog of C. elegans Y54F10AM.6. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA16762b.1 CJA16762b.1   [unknown]
Transcript:CJA16762a.1 CJA16762a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA16762a CJA16762a   [unknown]
CDS:CJA16762b CJA16762b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA14477, TTTCGAAATCTGGAAGGTCCTACGCAATCCCCGAAGATTTAACAATTGGAGTGATGAAGA, WBGene00133681   Expr1086837 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA16762, TTTCTACGTAGCTGAACGAGTATGCAGTGCTCGAGATTTGGGGAAGACACAAGTTGATTC, WBGene00135966   Expr1076021 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region