WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00135921 Gene Name  Cjp-vem-1
Sequence Name  ? CJA16716 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Cytochrome b5-like heme/steroid binding domain; Cytochrome b5-like Heme/Steroid binding domain; and Cytochrome b5-like heme/steroid binding domain superfamily. Is an ortholog of C. elegans vem-1. In C. elegans, vem-1 is involved in innate immune response. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA16716b.1 CJA16716b.1   [unknown]
Transcript:CJA16716a.1 CJA16716a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA16716a CJA16716a   [unknown]
CDS:CJA16716b CJA16716b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-vem-1, CGAGGAGCCGAATCGTTGGATTCTATCATCAATGGAGGCGAGGATGATAAGAAGAACAAC, WBGene00135921   Expr1089313 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region