Genomics
2 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG17431.1 | CBG17431.1 | [unknown] | |
| Transcript:CBG17431.2 | CBG17431.2 | [unknown] |
Other
8 Allele
| Public Name |
|---|
| WBVar00023547 |
| WBVar00023532 |
| WBVar00023517 |
| WBVar00023552 |
| WBVar00023537 |
| WBVar00023522 |
| WBVar00023542 |
| WBVar00023527 |
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly decreased expression in day 3 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day3_vs_Day1_downregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG17431, GAGAAAAATGACAACCACGGACCCAGATATCCCAGATCGAAGCTTCATTGGCCTGGTTTT, WBGene00037053 | Expr1069882 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
