Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG20114.1 | CBG20114.1 | [unknown] |
Other
24 Allele
| Public Name |
|---|
| WBVar00128223 |
| WBVar00128222 |
| WBVar00128221 |
| WBVar00128220 |
| WBVar00128227 |
| WBVar00128226 |
| WBVar00128225 |
| WBVar00128224 |
| WBVar00128241 |
| WBVar00128240 |
| WBVar00128243 |
| WBVar00128242 |
| WBVar00128239 |
| WBVar00128230 |
| WBVar00128234 |
| WBVar00128233 |
| WBVar00128232 |
| WBVar00128231 |
| WBVar00128238 |
| WBVar00128237 |
| WBVar00128236 |
| WBVar00128235 |
| WBVar00128229 |
| WBVar00128228 |
3 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly decreased expression in day 3 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day3_vs_Day1_downregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG20114, GGAGTCAAGGTGGAATATCTCCAGATTTCGGAATCAGCTAAGAATGCGTTGACTACTGTA, WBGene00039184 | Expr1054241 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
