WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00039472 Gene Name  Cbr-dip-2
Sequence Name  ? CBG20500 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: AMP-dependent synthetase/ligase; DMAP1-binding domain; AMP-binding enzyme; ANL, N-terminal domain; and DMAP1-binding Domain. Is an ortholog of C. elegans dip-2. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG20500.1 CBG20500.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG20500 CBG20500   [unknown]

0 RNAi Result

1 Allele

Public Name
WBVar00128704

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

3 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG20500, AACGATCATCGCCATCATCATATTCTGGAGCAGAGTGACGATGAAGCAGTTTATGTGAAT, WBGene00039472   Expr1066752 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG20499, AAACAAACGAGCAACAGCGAACGGCGGTGGGAGGATGTTGTCAGGTGGGAAAATTGCTTT, WBGene00039471   Expr1060544 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG20501, GATATCATCCGTTTGATGTGGAGAATACTGTTAGCAAGGCGCATCGATTCGTTGGAAATT, WBGene00039473   Expr1057168 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region