Genomics
2 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG15585a.1 | CBG15585a.1 | [unknown] | |
| Transcript:CBG15585b.1 | CBG15585b.1 | [unknown] |
Other
2 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:CBG15585b | CBG15585b | [unknown] | |
| CDS:CBG15585a | CBG15585a | [unknown] |
12 Allele
| Public Name |
|---|
| WBVar00122652 |
| WBVar00122651 |
| WBVar00122654 |
| WBVar00122653 |
| WBVar00122655 |
| WBVar00122650 |
| WBVar00122645 |
| WBVar00122644 |
| WBVar00122647 |
| WBVar00122646 |
| WBVar00122649 |
| WBVar00122648 |
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated |
2 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cbr-tag-241, AAACCCATTCAAAAACATGGGATCCCGATTGGTAGAACGTGTTCGTCGAAGTTTGTCAAG, WBGene00035775 | Expr1070175 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | ||
| CBG27922, AAGAACGGAGGAGGAGTTGGAAAGCTTCAAGTAATTTGGATAATGGAGGACCTGATGACG, WBGene00089336 | Expr1058908 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
