WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00035275 Gene Name  CBG14900
Sequence Name  ? CBG14900 Organism  Caenorhabditis briggsae
Automated Description  Is affected by Cbr-spr-4 based on RNA-seq studies. Is an ortholog of C. elegans F46F11.7. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG14900.1 CBG14900.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG14900 CBG14900   [unknown]

0 RNAi Result

1 Allele

Public Name
WBVar00121853

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day9_vs_Day6_upregulated
  Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16. DESeq2, FDR < 0.05. WBPaper00059178:Cbr-spr-4(gu163)_upregulated

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG14900, TTTGTAGAGATGGCAAGTGCGAGAAGGTACTCGATTCTTTCTGCATTGGACACGCAGATT, WBGene00035275   Expr1052410 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region