Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG14866.1 | CBG14866.1 | [unknown] |
Other
20 Allele
| Public Name |
|---|
| WBVar00121809 |
| WBVar00121800 |
| WBVar00121801 |
| WBVar00121802 |
| WBVar00121803 |
| WBVar00121804 |
| WBVar00121805 |
| WBVar00121806 |
| WBVar00121807 |
| WBVar00121808 |
| WBVar00121810 |
| WBVar00121811 |
| WBVar00121812 |
| WBVar00121813 |
| WBVar00121814 |
| WBVar00121815 |
| WBVar00121816 |
| WBVar00121817 |
| WBVar00121798 |
| WBVar00121799 |
1 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cbr-hot-5, AAATAGTGCAAGTGTGCTCCTGTGACAAAGACGGATGTAATTTCGACTCGATCAACGATT, WBGene00035249 | Expr1052250 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
