WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00034300 Gene Name  Cbr-aass-1
Sequence Name  ? CBG13546 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Alanine dehydrogenase/PNT, N-terminal domain; Saccharopine dehydrogenase-like, C-terminal; Saccharopine dehydrogenase, NADP binding domain; Saccharopine dehydrogenase NADP binding domain; Alanine dehydrogenase/pyridine nucleotide transhydrogenase, NAD(H)-binding domain; Alanine dehydrogenase/pyridine nucleotide transhydrogenase, N-terminal; Saccharopine dehydrogenase C-terminal domain; and NAD(P)-binding domain superfamily. Is an ortholog of C. elegans aass-1. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG13546a.1 CBG13546a.1   [unknown]
Transcript:CBG13546b.1 CBG13546b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG13546b CBG13546b   [unknown]
CDS:CBG13546a CBG13546a   [unknown]

0 RNAi Result

1 Allele

Public Name
WBVar00015512

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

5 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day9_vs_Day6_upregulated
  Transcripts that showed significantly decreased expression in day 3 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day3_vs_Day1_downregulated
  Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day6_vs_Day1_downregulated
  C.briggsae proteins that showed significantly increased at L4 larva stage than in emrbyo. Benjamin and Hochberg corrected p-value < 0.05. WBPaper00051425:CB_L4_vs_embryo_upregulated
  C.briggsae proteins that showed significantly increased at L1 larva stage than in emrbyo. Benjamin and Hochberg corrected p-value < 0.05. WBPaper00051425:CB_L1_vs_embryo_upregulated

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG13546, TCCCATATGGTCCTGAATAACGAAATTCAACGAGCCGGAATCCAACGTCCAATTTTGAAG, WBGene00034300   Expr1055266 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region