Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG13748.1 | CBG13748.1 | [unknown] |
Other
24 Allele
| Public Name |
|---|
| WBVar00015977 |
| WBVar00015982 |
| WBVar00015967 |
| WBVar00015962 |
| WBVar00015972 |
| WBVar00015917 |
| WBVar00015912 |
| WBVar00015907 |
| WBVar00015902 |
| WBVar00015957 |
| WBVar00015952 |
| WBVar00015947 |
| WBVar00015942 |
| WBVar00015937 |
| WBVar00015932 |
| WBVar00015927 |
| WBVar00015922 |
| WBVar00015877 |
| WBVar00015882 |
| WBVar00015867 |
| WBVar00015872 |
| WBVar00015897 |
| WBVar00015887 |
| WBVar00015892 |
1 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly decreased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_downregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG13748, TACAAGGTCGTCAGAATCCGGAGAGTCGGAAGCCACGTCATCAGCATCTAAGGCAAACTT, WBGene00034460 | Expr1070195 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
