WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00032973 Gene Name  Cbr-wdr-23
Sequence Name  ? CBG11954 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: WD repeat protein DCAF11/LEC14B; WD domain, G-beta repeat; WD40 repeat; WD40/YVTN repeat-like-containing domain superfamily; and WD40-repeat-containing domain superfamily. Is an ortholog of C. elegans wdr-23. In C. elegans, wdr-23 is involved in several processes, including determination of adult lifespan; negative regulation of cellular response to manganese ion; and negative regulation of transcription by RNA polymerase II. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG11954d.1 CBG11954d.1   [unknown]
Transcript:CBG11954c.1 CBG11954c.1   [unknown]
Transcript:CBG11954b.1 CBG11954b.1   [unknown]
Transcript:CBG11954a.1 CBG11954a.1   [unknown]
 

Other

4 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG11954d CBG11954d   [unknown]
CDS:CBG11954c CBG11954c   [unknown]
CDS:CBG11954b CBG11954b   [unknown]
CDS:CBG11954a CBG11954a   [unknown]

0 RNAi Result

2 Allele

Public Name
WBVar00014237
WBVar00014232

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly decreased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day9_vs_Day6_downregulated
Heat shock: 34C 30min. Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min. DESeq2 v 1.18.1, fold change > 2, FDR < 0.01. WBPaper00058955:heatshock_upregulated_CBG

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-wdr-23, AAGGCGTTATTGCTCCATACGACCATCCAAATATTCACCAATTCGGCGACGAAGATTCAT, WBGene00032973   Expr1057191 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region