WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00035612 Gene Name  Cbr-pod-1
Sequence Name  ? CBG15309 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Anaphase-promoting complex subunit 4 WD40 domain; Type of WD40 repeat; Coronin; Domain of unknown function (DUF1899); Quinoprotein alcohol dehydrogenase-like superfamily; Coronin 7; Domain of unknown function DUF1899; WD40 repeat; WD40/YVTN repeat-like-containing domain superfamily; and Anaphase-promoting complex subunit 4, WD40 domain. Is an ortholog of C. elegans pod-1. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

6 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG15309d.2 CBG15309d.2   [unknown]
Transcript:CBG15309d.1 CBG15309d.1   [unknown]
Transcript:CBG15309a.1 CBG15309a.1   [unknown]
Transcript:CBG15309b.1 CBG15309b.1   [unknown]
Transcript:CBG15309c.1 CBG15309c.1   [unknown]
Transcript:CBG15309c.2 CBG15309c.2   [unknown]
 

Other

4 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG15309d CBG15309d   [unknown]
CDS:CBG15309a CBG15309a   [unknown]
CDS:CBG15309b CBG15309b   [unknown]
CDS:CBG15309c CBG15309c   [unknown]

0 RNAi Result

2 Allele

Public Name
WBVar00013649
WBVar00013644

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-pod-1, GTTGGCTCCGTTTATGTCCCCAGTTGGAAGTCAAGGAATCGCTTTCCATCATAAGATTAA, WBGene00035612   Expr1065591 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region