Genomics
2 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG00264.2 | CBG00264.2 | [unknown] | |
| Transcript:CBG00264.1 | CBG00264.1 | [unknown] |
Other
20 Allele
| Public Name |
|---|
| WBVar00060858 |
| WBVar00060828 |
| WBVar00060798 |
| WBVar00060833 |
| WBVar00060803 |
| WBVar00060773 |
| WBVar00060838 |
| WBVar00060808 |
| WBVar00060778 |
| WBVar00060843 |
| WBVar00060813 |
| WBVar00060783 |
| WBVar00060848 |
| WBVar00060818 |
| WBVar00060788 |
| WBVar00060853 |
| WBVar00060823 |
| WBVar00060793 |
| WBVar00060763 |
| WBVar00060768 |
4 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly decreased expression in day 3 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day3_vs_Day1_downregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated | |
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day1_upregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cbr-lact-7, TAGTGCGGCAATGTTGGTCCGGTTGGACAATGGATTAGAGATGGCTGTCACTGTCAATAA, WBGene00023689 | Expr1061211 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
