Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG16257.1 | CBG16257.1 | [unknown] |
Other
12 Allele
| Public Name |
|---|
| WBVar00055584 |
| WBVar00123705 |
| WBVar00123707 |
| WBVar00123706 |
| WBVar00123708 |
| WBVar00024029 |
| WBVar00024014 |
| WBVar00024034 |
| WBVar00024019 |
| WBVar00024004 |
| WBVar00024024 |
| WBVar00024009 |
3 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly decreased expression in day 9 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day1_downregulated | |
| Transcripts that showed significantly decreased expression in day 3 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day3_vs_Day1_downregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG16257, CAAGAGCAGTCCGACAATATCGCTTCTGGACACTTTGGAAAGATGATGAGCTATCAGATA, WBGene00036259 | Expr1061584 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
