Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG12974.1 | CBG12974.1 | [unknown] |
Other
10 Allele
| Public Name |
|---|
| WBVar00119259 |
| WBVar00119257 |
| WBVar00119258 |
| WBVar00119260 |
| WBVar00026524 |
| WBVar00026509 |
| WBVar00026529 |
| WBVar00026514 |
| WBVar00026534 |
| WBVar00026519 |
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated |
3 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG12974, TCGTTGAGACCGAGCAGGCTTCTGAAGTCAAGATGAGAGAGAAAGGCGAAGAGCGTAGAA, WBGene00033825 | Expr1059184 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | ||
| CBG12976, TTCAAGCAAGTCGCCGAAAGCTGTGCAGTCATGATCAAGAACACTGGAGTAGAGCGTGGA, WBGene00033827 | Expr1061050 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | ||
| Cbr-tag-308, TCATTCGGTCAAGTCACGAATACGAGGAAACTCAGAAGACATTGAGACATCGTAGCGCTT, WBGene00033826 | Expr1054794 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
