WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00033254 Gene Name  Cbr-ran-2
Sequence Name  ? CBG12282 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Leucine-rich repeat domain superfamily; Leucine-rich repeat; and Leucine Rich repeat. Is an ortholog of C. elegans ran-2. In C. elegans, ran-2 is involved in embryo development. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG12282a.1 CBG12282a.1   [unknown]
Transcript:CBG12282b.1 CBG12282b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG12282a CBG12282a   [unknown]
CDS:CBG12282b CBG12282b   [unknown]

0 RNAi Result

1 Allele

Public Name
WBVar00118451

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  C.briggsae proteins that showed significantly decreased at L4 larva stage than in emrbyo. Benjamin and Hochberg corrected p-value < 0.05. WBPaper00051425:CB_L4_vs_embryo_downregulated

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-ran-2, GTGAAGCGCAATCCGATTCCAGCGACCGCTCAACTCGTCAACAATATCGTTGCTCAGTGC, WBGene00033254   Expr1059170 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region