WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00032251 Gene Name  Cbr-unc-52
Sequence Name  ? CBG11064 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Low-density lipoprotein receptor domain class A; Laminin-type EGF domain; Immunoglobulin domain; Laminin B (Domain IV); Immunoglobulin subtype 2; Low-density lipoprotein (LDL) receptor class A repeat; Laminin IV; Immunoglobulin subtype; Immunoglobulin-like fold; Immunoglobulin-like domain superfamily; LDL receptor-like superfamily; Laminin EGF domain; and Immunoglobulin-like domain. Is an ortholog of C. elegans unc-52. In C. elegans, unc-52 is involved in several processes, including hemidesmosome assembly; muscle cell cellular homeostasis; and muscle structure development. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

8 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG11064e.1 CBG11064e.1   [unknown]
Transcript:CBG11064d.1 CBG11064d.1   [unknown]
Transcript:CBG11064c.1 CBG11064c.1   [unknown]
Transcript:CBG11064b.1 CBG11064b.1   [unknown]
Transcript:CBG11064a.1 CBG11064a.1   [unknown]
Transcript:CBG11064h.1 CBG11064h.1   [unknown]
Transcript:CBG11064g.1 CBG11064g.1   [unknown]
Transcript:CBG11064f.1 CBG11064f.1   [unknown]
 

Other

8 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG11064h CBG11064h   [unknown]
CDS:CBG11064g CBG11064g   [unknown]
CDS:CBG11064f CBG11064f   [unknown]
CDS:CBG11064a CBG11064a   [unknown]
CDS:CBG11064e CBG11064e   [unknown]
CDS:CBG11064d CBG11064d   [unknown]
CDS:CBG11064c CBG11064c   [unknown]
CDS:CBG11064b CBG11064b   [unknown]

0 RNAi Result

5 Allele

Public Name
WBVar00116389
WBVar00116391
WBVar00116390
WBVar00012542
WBVar00012537

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

3 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day9_vs_Day6_upregulated
  Transcripts that showed significantly decreased expression in day 3 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day3_vs_Day1_downregulated
  Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day6_vs_Day1_downregulated

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-unc-52, TTCAAACGAGAACTGTCCTGAACGTTGGATCCGGAAAACGCAAGCGAAAACATCTGGGGA, WBGene00032251   Expr1062347 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG11065, GTGATGGAGTAGATGACTGTGGAGATGGATCAGATGAAACAAACTGTGATTCGAATGAAG, WBGene00032252   Expr1066407 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region