Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG18749.1 | CBG18749.1 | [unknown] |
Other
12 Allele
| Public Name |
|---|
| WBVar00009739 |
| WBVar00126911 |
| WBVar00126910 |
| WBVar00126915 |
| WBVar00126914 |
| WBVar00126913 |
| WBVar00126912 |
| WBVar00126916 |
| WBVar00126908 |
| WBVar00126907 |
| WBVar00126906 |
| WBVar00126909 |
3 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 3 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day3_vs_Day1_upregulated | |
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 3 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day3_downregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG18749, ACACCCTAAAATCTGGAGACAAACATGACTCAGATCTGGTTGATCTGAATCAGAGAAACG, WBGene00038113 | Expr1059742 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
