WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00029986 Gene Name  CBG08128
Sequence Name  ? CBG08128 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Tumour protein p53-inducible protein 11 and Tumor protein p53-inducible protein 11. Is an ortholog of C. elegans Y9C12A.1. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG08128a.2 CBG08128a.2   [unknown]
Transcript:CBG08128a.1 CBG08128a.1   [unknown]
Transcript:CBG08128b.1 CBG08128b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG08128b CBG08128b   [unknown]
CDS:CBG08128a CBG08128a   [unknown]

0 RNAi Result

4 Allele

Public Name
WBVar00113134
WBVar00013454
WBVar00013459
WBVar00013449

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly decreased expression in day 3 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day3_vs_Day1_downregulated
  Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day6_vs_Day1_downregulated

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG08129, TCGGAACCTATTTCTACTGTCATGGATTAAAAGCAACAAAGGGAAGATTCGACTTTGGAC, WBGene00029987   Expr1068870 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG08128, GAAAATCGAGCGGACATCGCACTGCTTTTGTTGGTCACTGCAGTTTTCCATATAGTTGTT, WBGene00029986   Expr1065271 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region