WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00029565 Gene Name  Cbr-syg-2
Sequence Name  ? CBG07568 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Immunoglobulin domain; Immunoglobulin I-set; Immunoglobulin subtype 2; Fibronectin type III domain; Immunoglobulin subtype; Fibronectin type III; Immunoglobulin-like fold; Immunoglobulin I-set domain; Fibronectin type III superfamily; Immunoglobulin-like domain superfamily; CD80-like C2-set immunoglobulin domain; and CD80-like, immunoglobulin C2-set. Is an ortholog of C. elegans syg-2. In C. elegans, syg-2 is involved in several processes, including cell-cell adhesion; nervous system development; and protein localization to synapse. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG07568b.1 CBG07568b.1   [unknown]
Transcript:CBG07568a.1 CBG07568a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG07568a CBG07568a   [unknown]
CDS:CBG07568b CBG07568b   [unknown]

0 RNAi Result

2 Allele

Public Name
WBVar00008312
WBVar00008317

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

4 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day9_vs_Day6_upregulated
  Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day6_vs_Day1_downregulated
  Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day9_vs_Day1_upregulated
  Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 3 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day6_vs_Day3_downregulated

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-syg-2, CAAGAACAGCAATTAACGGCGGCGATGTCCGTCAAGTCCAAATGTACGGAACGATGATGG, WBGene00029565   Expr1061268 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region