WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00028535 Gene Name  Cbr-mon-2
Sequence Name  ? CBG06228 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Dimerisation and cyclophilin-binding domain of Mon2; C-terminal region of Mon2 protein; Guanine nucleotide exchange factor, N-terminal; Protein Mon2-like; Guanine nucleotide exchange factor in Golgi transport N-terminal; Mon2, dimerisation and cyclophilin-binding domain; Mon2, C-terminal; and Armadillo-type fold. Is an ortholog of C. elegans mon-2. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG06228a.1 CBG06228a.1   [unknown]
Transcript:CBG06228b.1 CBG06228b.1   [unknown]
Transcript:CBG06228c.1 CBG06228c.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG06228a CBG06228a   [unknown]
CDS:CBG06228c CBG06228c   [unknown]
CDS:CBG06228b CBG06228b   [unknown]

0 RNAi Result

1 Allele

Public Name
WBVar00110941

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG06228, GATGTCATGCCATGCTGTCATGCTGATGGTCAACTCGAACAGCAGCTCATCAAAACGATA, WBGene00028535   Expr1052785 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region