WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00029427 Gene Name  Cbr-hlb-1
Sequence Name  ? CBG07358 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: LAR-interacting protein, Liprin; Sterile alpha motif domain; SAM domain (Sterile alpha motif); Sterile alpha motif/pointed domain superfamily; and Liprin-beta. Is an ortholog of C. elegans hlb-1. In C. elegans, hlb-1 is involved in neuromuscular junction development; positive regulation of locomotion; and regulation of nematode pharyngeal pumping. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

9 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG07358a.1 CBG07358a.1   [unknown]
Transcript:CBG07358b.1 CBG07358b.1   [unknown]
Transcript:CBG07358e.1 CBG07358e.1   [unknown]
Transcript:CBG07358f.1 CBG07358f.1   [unknown]
Transcript:CBG07358c.1 CBG07358c.1   [unknown]
Transcript:CBG07358d.1 CBG07358d.1   [unknown]
Transcript:CBG07358i.1 CBG07358i.1   [unknown]
Transcript:CBG07358g.1 CBG07358g.1   [unknown]
Transcript:CBG07358h.1 CBG07358h.1   [unknown]
 

Other

9 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG07358g CBG07358g   [unknown]
CDS:CBG07358h CBG07358h   [unknown]
CDS:CBG07358i CBG07358i   [unknown]
CDS:CBG07358c CBG07358c   [unknown]
CDS:CBG07358d CBG07358d   [unknown]
CDS:CBG07358e CBG07358e   [unknown]
CDS:CBG07358f CBG07358f   [unknown]
CDS:CBG07358a CBG07358a   [unknown]
CDS:CBG07358b CBG07358b   [unknown]

0 RNAi Result

4 Allele

Public Name
WBVar00007417
WBVar00112221
WBVar00112220
WBVar00016274

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day9_vs_Day6_upregulated
  Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day6_vs_Day1_downregulated

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG07357, TTTTCAACCCACCAAGGATCTATCAGGAATTTGTGAAGGCTATCGACGAGCACACAATGA, WBGene00029426   Expr1058684 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cbr-hlb-1, GCCAGAAGATCATTGCCGATAAGCGGGATTTCCTGGCTGCCGGCAACTATCCGCAAATCT, WBGene00029427   Expr1052664 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region