Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG05224.1 | CBG05224.1 | [unknown] |
Other
30 Allele
| Public Name |
|---|
| WBVar00004867 |
| WBVar00004872 |
| WBVar00004862 |
| WBVar00004877 |
| WBVar00004882 |
| WBVar00050872 |
| WBVar00050877 |
| WBVar00050847 |
| WBVar00050842 |
| WBVar00050832 |
| WBVar00050837 |
| WBVar00050867 |
| WBVar00050862 |
| WBVar00050857 |
| WBVar00050852 |
| WBVar00050802 |
| WBVar00050807 |
| WBVar00050822 |
| WBVar00050827 |
| WBVar00050812 |
| WBVar00050817 |
| WBVar00050762 |
| WBVar00050757 |
| WBVar00050752 |
| WBVar00050782 |
| WBVar00050787 |
| WBVar00050777 |
| WBVar00050747 |
| WBVar00050742 |
| WBVar00050737 |
1 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day1_upregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG05224, GGGTATGGTGGAACGGAGTAACAGATATGGCAAGACTGCTGATTGCATAAAGTCGGAGTA, WBGene00027733 | Expr1068060 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
