Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG09307.1 | CBG09307.1 | [unknown] |
Other
11 Allele
| Public Name |
|---|
| WBVar00004284 |
| WBVar00114756 |
| WBVar00114759 |
| WBVar00114758 |
| WBVar00114757 |
| WBVar00114763 |
| WBVar00114762 |
| WBVar00114761 |
| WBVar00114760 |
| WBVar00114765 |
| WBVar00114764 |
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly decreased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_downregulated | |
| Heat shock: 34C 30min. | Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min. | DESeq2 v 1.18.1, fold change > 2, FDR < 0.01. | WBPaper00058955:heatshock_upregulated_CBG |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG09307, GATGTGTGTGGAGAAGCACGCAAACTTCGATTCTCTGTTTCCAAGAAAACTGAGTTTGAG, WBGene00030912 | Expr1061343 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
