Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG17307.1 | CBG17307.1 | [unknown] |
Other
30 Allele
| Public Name |
|---|
| WBVar00049829 |
| WBVar00049824 |
| WBVar00019004 |
| WBVar00019044 |
| WBVar00019049 |
| WBVar00019034 |
| WBVar00019039 |
| WBVar00019024 |
| WBVar00019029 |
| WBVar00019014 |
| WBVar00019019 |
| WBVar00019009 |
| WBVar00019064 |
| WBVar00019054 |
| WBVar00019059 |
| WBVar00018994 |
| WBVar00018989 |
| WBVar00018984 |
| WBVar00018979 |
| WBVar00018974 |
| WBVar00018969 |
| WBVar00018999 |
| WBVar00125100 |
| WBVar00125101 |
| WBVar00125094 |
| WBVar00125095 |
| WBVar00125098 |
| WBVar00125099 |
| WBVar00125096 |
| WBVar00125097 |
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day1_upregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cbr-sdc-2, CGGTTATGAATTCCTTTTTCAACATTGAACCCATGAAGCGGCAAATTCATGAGCTTCGTC, WBGene00036977 | Expr1057546 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
