Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG13742.1 | CBG13742.1 | [unknown] |
Other
21 Allele
| Public Name |
|---|
| WBVar00046459 |
| WBVar00120281 |
| WBVar00120282 |
| WBVar00120283 |
| WBVar00120284 |
| WBVar00120285 |
| WBVar00120290 |
| WBVar00120291 |
| WBVar00120292 |
| WBVar00120293 |
| WBVar00120294 |
| WBVar00120286 |
| WBVar00120287 |
| WBVar00120288 |
| WBVar00120289 |
| WBVar00016934 |
| WBVar00016939 |
| WBVar00016924 |
| WBVar00016929 |
| WBVar00016914 |
| WBVar00016919 |
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly decreased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_downregulated | |
| Transcripts that showed significantly increased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_upregulated |
2 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG13743, GAAGCCAACATCTAGAAGAGGTCGTCCGTCGAGATATGAGAAGGATGAAGAAGAGGAGGA, WBGene00034457 | Expr1068445 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | ||
| CBG13742, CACCCCATCGCCTCTCGTTTTAGAGATTCTGAAGACTTTTTGTCTCCAGATGAGAAAAAG, WBGene00034456 | Expr1056442 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
