Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG13880.1 | CBG13880.1 | [unknown] |
Other
28 Allele
| Public Name |
|---|
| WBVar00045507 |
| WBVar00045502 |
| WBVar00045517 |
| WBVar00045512 |
| WBVar00045527 |
| WBVar00045522 |
| WBVar00045532 |
| WBVar00045537 |
| WBVar00045542 |
| WBVar00045547 |
| WBVar00016107 |
| WBVar00016112 |
| WBVar00016102 |
| WBVar00016057 |
| WBVar00016052 |
| WBVar00016047 |
| WBVar00016042 |
| WBVar00016037 |
| WBVar00016097 |
| WBVar00016092 |
| WBVar00016087 |
| WBVar00016082 |
| WBVar00016077 |
| WBVar00016072 |
| WBVar00016067 |
| WBVar00016062 |
| WBVar00120445 |
| WBVar00120446 |
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly decreased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_downregulated | |
| Transcripts that showed significantly increased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_upregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cbr-mdf-2, TCGTTCTCCACATCGGTCCACGGCGTGAACACCAATGTACAGTACAAGGCGGATTTTTAA, WBGene00034566 | Expr1066345 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
