Genomics
4 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG01714c.1 | CBG01714c.1 | [unknown] | |
| Transcript:CBG01714d.1 | CBG01714d.1 | [unknown] | |
| Transcript:CBG01714a.1 | CBG01714a.1 | [unknown] | |
| Transcript:CBG01714b.1 | CBG01714b.1 | [unknown] |
Other
4 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:CBG01714b | CBG01714b | [unknown] | |
| CDS:CBG01714a | CBG01714a | [unknown] | |
| CDS:CBG01714d | CBG01714d | [unknown] | |
| CDS:CBG01714c | CBG01714c | [unknown] |
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated |
2 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG01714, CTGAAGAGATGTACTAATCCAGATTTGATGAGGTTACAGAGAACTACCGAAATCCGAGAG, WBGene00024909 | Expr1056549 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | ||
| CBG01713, GTCTTCGTTCAACCAGATAGCCTGGTGGAAGGAAAAGTGACTGTCCGAACGGAGCACAAT, WBGene00024908 | Expr1067899 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
