WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00028447 Gene Name  Cbr-mig-38
Sequence Name  ? CBG06120 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Conserved region of unknown function on GLTSCR protein and GLTSCR protein, conserved region. Is an ortholog of C. elegans mig-38. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG06120a.1 CBG06120a.1   [unknown]
Transcript:CBG06120b.3 CBG06120b.3   [unknown]
Transcript:CBG06120b.1 CBG06120b.1   [unknown]
Transcript:CBG06120b.2 CBG06120b.2   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG06120b CBG06120b   [unknown]
CDS:CBG06120a CBG06120a   [unknown]

0 RNAi Result

1 Allele

Public Name
WBVar00044942

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in day 3 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day3_vs_Day1_upregulated

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG06120, TGAAAAGCAAACTGAAAAAACCGGTCAACGGAGCCGCGCCTATTCTTCCCTGGTCAACTG, WBGene00028447   Expr1050498 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region