Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG03177.1 | CBG03177.1 | [unknown] |
Other
35 Allele
| Public Name |
|---|
| WBVar00108111 |
| WBVar00108110 |
| WBVar00108119 |
| WBVar00108118 |
| WBVar00108117 |
| WBVar00108116 |
| WBVar00108115 |
| WBVar00108114 |
| WBVar00108113 |
| WBVar00108112 |
| WBVar00108122 |
| WBVar00108121 |
| WBVar00108120 |
| WBVar00108129 |
| WBVar00108128 |
| WBVar00108127 |
| WBVar00108126 |
| WBVar00108125 |
| WBVar00108124 |
| WBVar00108123 |
| WBVar00108133 |
| WBVar00108132 |
| WBVar00108131 |
| WBVar00108130 |
| WBVar00108139 |
| WBVar00108138 |
| WBVar00108137 |
| WBVar00108136 |
| WBVar00108135 |
| WBVar00108134 |
4 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly decreased expression in day 3 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day3_vs_Day1_downregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated | |
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day1_upregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG03177, GCCACAATGTGCTAGCCAATGCGTCGATCAATGCAAAACCCAACTTCTGACCCAAGTTGA, WBGene00026090 | Expr1053278 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
