Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG02150.1 | CBG02150.1 | [unknown] |
Other
21 Allele
| Public Name |
|---|
| WBVar00107077 |
| WBVar00107079 |
| WBVar00107078 |
| WBVar00107088 |
| WBVar00107087 |
| WBVar00107086 |
| WBVar00107085 |
| WBVar00107084 |
| WBVar00107083 |
| WBVar00107082 |
| WBVar00107081 |
| WBVar00107089 |
| WBVar00107080 |
| WBVar00107097 |
| WBVar00107096 |
| WBVar00107095 |
| WBVar00107094 |
| WBVar00107093 |
| WBVar00107092 |
| WBVar00107091 |
| WBVar00107090 |
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 3 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day3_vs_Day1_upregulated | |
| Transcripts that showed significantly increased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_upregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG02150, GACAAAGGAACGAATGCGAAAAGGGCCTATGCTACAGATGCTTGGACCACGAGGATGATA, WBGene00025254 | Expr1068583 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
