Genomics
2 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG26414b.1 | CBG26414b.1 | [unknown] | |
| Transcript:CBG26414a.1 | CBG26414a.1 | [unknown] |
Other
2 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:CBG26414a | CBG26414a | [unknown] | |
| CDS:CBG26414b | CBG26414b | [unknown] |
8 Allele
| Public Name |
|---|
| WBVar00039589 |
| WBVar00039584 |
| WBVar00039599 |
| WBVar00039594 |
| WBVar00011309 |
| WBVar00011304 |
| WBVar00011299 |
| WBVar00011294 |
1 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day1_upregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG26414, TCCACTGAAAAGAGTGACGTGTCAAGAGTGTAATCGAGAAGTCAGCAACGTACATGCCGA, WBGene00087828 | Expr1050745 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
