Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG00478.1 | CBG00478.1 | [unknown] |
Other
23 Allele
| Public Name |
|---|
| WBVar00141296 |
| WBVar00141297 |
| WBVar00141298 |
| WBVar00141278 |
| WBVar00141279 |
| WBVar00141276 |
| WBVar00141277 |
| WBVar00141281 |
| WBVar00141282 |
| WBVar00141283 |
| WBVar00141284 |
| WBVar00141280 |
| WBVar00141289 |
| WBVar00141285 |
| WBVar00141286 |
| WBVar00141287 |
| WBVar00141288 |
| WBVar00141292 |
| WBVar00141293 |
| WBVar00141294 |
| WBVar00141295 |
| WBVar00141290 |
| WBVar00141291 |
4 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated | |
| Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-spr-4(gu163)_upregulated | |
| Virus infection: Santeuil infected at L3 larva stage for 12 hours. | Transcripts that showed signicantly increased expression after Santeuil virus infection to C. briggsae strain JU1264. | edgeR, FDR < 0.05. | WBPaper00051137:Santeuil-virus_upregulated_JU1264 |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG00478, GAACCCAGAAAAGCCCATAAAAATGGGAGATTGGGTGAATTTGAAATTCACGTCTTCTGA, WBGene00023858 | Expr1062550 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
