Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG00742.1 | CBG00742.1 | [unknown] |
Other
12 Allele
| Public Name |
|---|
| WBVar00141465 |
| WBVar00141464 |
| WBVar00043059 |
| WBVar00014634 |
| WBVar00064043 |
| WBVar00064028 |
| WBVar00014639 |
| WBVar00064033 |
| WBVar00014644 |
| WBVar00014629 |
| WBVar00064038 |
| WBVar00014649 |
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day1_upregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG00742, AACTCCACAGACCTTCTATTCATCCATTTGGCAATGCAGCACACACAGGAACTTGCTCAA, WBGene00024085 | Expr1054974 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
