Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG04342.1 | CBG04342.1 | [unknown] |
Other
10 Allele
| Public Name |
|---|
| WBVar00033649 |
| WBVar00033644 |
| WBVar00033659 |
| WBVar00033654 |
| WBVar00033669 |
| WBVar00033664 |
| WBVar00033674 |
| WBVar00033679 |
| WBVar00033684 |
| WBVar00033689 |
3 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly decreased expression in day 3 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day3_vs_Day1_downregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated |
2 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG04342, ATTGATGCGAGTCTTCTGGAAGAGTATTTGGAGATGAAGATAAGTGGAGGATTGAAGGAA, WBGene00027043 | Expr1063102 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | ||
| CBG04349, GATTGGAAATGATGAAGACGTTGGATGTTGAGAATTTAGGAATCAAAGACTCCTGGGACC, WBGene00027046 | Expr1052606 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
