WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00041618 Gene Name  CBG23227
Sequence Name  ? CBG23227 Organism  Caenorhabditis briggsae
Automated Description  Is affected by Cbr-htz-1 and Cbr-spr-4 based on RNA-seq studies. Is an ortholog of C. elegans F01G10.5 and lin-5. In C. elegans, lin-5 is involved in several processes, including gonad development; microtubule cytoskeleton organization; and regulation of protein localization. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

6 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG23227.1 CBG23227.1   [unknown]
Transcript:CBG23227.2 CBG23227.2   [unknown]
Transcript:CBG23227.3 CBG23227.3   [unknown]
Transcript:CBG23227.4 CBG23227.4   [unknown]
Transcript:CBG23227.5 CBG23227.5   [unknown]
Transcript:CBG23227.6 CBG23227.6   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG23227 CBG23227   [unknown]

0 RNAi Result

3 Allele

Public Name
WBVar00132932
WBVar00132933
WBVar00000723

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in Cbr-htz-1(gu167) comparing to in AF16. DESeq2, FDR < 0.05. WBPaper00059178:Cbr-htz-1(gu167)_upregulated
  Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16. DESeq2, FDR < 0.05. WBPaper00059178:Cbr-spr-4(gu163)_upregulated

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-lin-5, GTCGGGAGATGAGGAGAACGTTCGAAGAGGTGGTGCTGCTGGAGAGAAGAAGCAAAAGAA, WBGene00041618   Expr1058081 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG23228, AACAATTGCGTGGTGTCTGAAGCGAGCTGAGATGTTGTTCAAGTGTGTTAAGGGATATTT, WBGene00041619   Expr1066073 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region