WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00038199 Gene Name  Cbr-rme-1
Sequence Name  ? CBG18887 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: EF-hand domain pair; Domain of unknown function DUF5600; Cytoskeletal-regulatory complex EF hand; Dynamin; EH domain-containing protein, N-terminal; EH domain; Domain of unknown function (DUF5600); Dynamin family; P-loop containing nucleoside triphosphate hydrolase; EH domain-containing protein 1/3; and N-terminal EH-domain containing protein. Is an ortholog of C. elegans rme-1. In C. elegans, rme-1 is involved in several processes, including endocytic recycling; lipid tube assembly involved in organelle fission; and necroptotic process. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG18887a.1 CBG18887a.1   [unknown]
Transcript:CBG18887b.1 CBG18887b.1   [unknown]
Transcript:CBG18887c.1 CBG18887c.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG18887a CBG18887a   [unknown]
CDS:CBG18887c CBG18887c   [unknown]
CDS:CBG18887b CBG18887b   [unknown]

0 RNAi Result

1 Allele

Public Name
WBVar00138902

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-rme-1, CACCATCGAAACGAGGAGTCCAGGATCCAGTTTATCCAACTCTCAATGATAATGATGAAT, WBGene00038199   Expr1061161 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region