WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00039889 Gene Name  Cbr-cacn-1
Sequence Name  ? CBG20998 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Cactus-binding C-terminus of cactin protein; Cactin, C-terminal; Conserved mid region of cactin; and Cactin, central domain. Is an ortholog of C. elegans cacn-1. In C. elegans, cacn-1 is involved in several processes, including gonad development; positive regulation of cell migration; and regulation of Wnt signaling pathway. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG20998.1 CBG20998.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG20998 CBG20998   [unknown]

0 RNAi Result

1 Allele

Public Name
WBVar00139460

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-cacn-1, AATCTATAGATGATTTCGAGGATTTGCTAGAGGATATCAGTACTTATCGAGAACTGGATG, WBGene00039889   Expr1060963 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region