Genomics
2 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG22035.2 | CBG22035.2 | [unknown] | |
| Transcript:CBG22035.1 | CBG22035.1 | [unknown] |
Other
11 Allele
| Public Name |
|---|
| WBVar00139788 |
| WBVar00139789 |
| WBVar00139790 |
| WBVar00139791 |
| WBVar00139794 |
| WBVar00139795 |
| WBVar00139792 |
| WBVar00139793 |
| WBVar00139798 |
| WBVar00139796 |
| WBVar00139797 |
1 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly decreased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_downregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG22035, ATATCCACCGGGATACCTCAGAGAGTCGCTGAAACACGAGTACGGAACGCTGAAAATATT, WBGene00040678 | Expr1067531 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
