Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG14131.1 | CBG14131.1 | [unknown] |
Other
11 Allele
| Public Name |
|---|
| WBVar00138047 |
| WBVar00120990 |
| WBVar00120991 |
| WBVar00120992 |
| WBVar00120983 |
| WBVar00120984 |
| WBVar00120985 |
| WBVar00120986 |
| WBVar00120987 |
| WBVar00120988 |
| WBVar00120989 |
3 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated | |
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day1_upregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cbr-wrt-2, TGCCGAAACTTCAGATTCCAAGTGTTGAAGATGTTGAGCAAGTGATTCCACCAGTGCAAC, WBGene00034729 | Expr1067091 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
