Genomics
2 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG17445.1 | CBG17445.1 | [unknown] | |
| Transcript:CBG17445.2 | CBG17445.2 | [unknown] |
Other
12 Allele
| Public Name |
|---|
| WBVar00138615 |
| WBVar00138617 |
| WBVar00138616 |
| WBVar00138619 |
| WBVar00138618 |
| WBVar00041689 |
| WBVar00041684 |
| WBVar00041699 |
| WBVar00041694 |
| WBVar00041709 |
| WBVar00041704 |
| WBVar00125380 |
3 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly decreased expression in day 3 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day3_vs_Day1_downregulated | |
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day1_upregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG17445, GAGCACTACTATCACCACACACTATCCAGAGAAGATGCAGATCGAGTATTCTGCGAATGT, WBGene00037060 | Expr1059807 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
