Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG06318.1 | CBG06318.1 | [unknown] |
Other
6 Allele
| Public Name |
|---|
| WBVar00136484 |
| WBVar00136486 |
| WBVar00136485 |
| WBVar00136488 |
| WBVar00136487 |
| WBVar00136489 |
3 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 3 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day3_downregulated |
2 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG27341, CATTATCGAAAAAATCAACCAATCAAAAAATCGATACCATGGAAACGAGTAGTTTTTTAA, WBGene00088755 | Expr1070241 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | ||
| Cbr-ketn-1, AAGTTTAGCGCCGAAGTTGATGGAAATCCAGAGCCAAGTGTCATCTGGCAGTTCAAGGGA, WBGene00028613 | Expr1065835 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
