Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG06738.1 | CBG06738.1 | [unknown] |
Other
23 Allele
| Public Name |
|---|
| WBVar00136518 |
| WBVar00136517 |
| WBVar00136519 |
| WBVar00136521 |
| WBVar00136520 |
| WBVar00136523 |
| WBVar00136522 |
| WBVar00136525 |
| WBVar00136524 |
| WBVar00136527 |
| WBVar00136526 |
| WBVar00136529 |
| WBVar00136528 |
| WBVar00136530 |
| WBVar00111673 |
| WBVar00111674 |
| WBVar00111668 |
| WBVar00111669 |
| WBVar00111666 |
| WBVar00111667 |
| WBVar00111671 |
| WBVar00111672 |
| WBVar00111670 |
3 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly decreased expression in day 3 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day3_vs_Day1_downregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG06738, GGATTCCTGGTGTTGATCATTATTTCGATTTGGATGAACAAGTACTGAAACGACTTGAAA, WBGene00028971 | Expr1052468 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
