Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG07159.1 | CBG07159.1 | [unknown] |
Other
22 Allele
| Public Name |
|---|
| WBVar00136589 |
| WBVar00136588 |
| WBVar00136590 |
| WBVar00136592 |
| WBVar00136591 |
| WBVar00136594 |
| WBVar00136593 |
| WBVar00136596 |
| WBVar00136595 |
| WBVar00046814 |
| WBVar00046819 |
| WBVar00046829 |
| WBVar00046824 |
| WBVar00046804 |
| WBVar00046809 |
| WBVar00046799 |
| WBVar00112023 |
| WBVar00112024 |
| WBVar00112025 |
| WBVar00112026 |
| WBVar00017244 |
| WBVar00017239 |
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly decreased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_downregulated | |
| Transcripts that showed significantly decreased expression in Cbr-spr-4(gu163) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-spr-4(gu163)_downregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG07159, GGACAATCCGAATGTGTTGCGGGTGGTGCCAAAACACTATGTGCATACGACAAGCTATCT, WBGene00029301 | Expr1054430 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
