Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG00306.1 | CBG00306.1 | [unknown] |
Other
22 Allele
| Public Name |
|---|
| WBVar00135548 |
| WBVar00135549 |
| WBVar00135550 |
| WBVar00135551 |
| WBVar00141119 |
| WBVar00039339 |
| WBVar00061178 |
| WBVar00061183 |
| WBVar00061188 |
| WBVar00061193 |
| WBVar00061198 |
| WBVar00061203 |
| WBVar00061208 |
| WBVar00061213 |
| WBVar00061218 |
| WBVar00061223 |
| WBVar00061228 |
| WBVar00061233 |
| WBVar00061238 |
| WBVar00061243 |
| WBVar00061248 |
| WBVar00061253 |
4 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-spr-4(gu163)_upregulated | |
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day1_upregulated | |
| Transcripts that showed significantly decreased expression in Cbr-htz-1(gu167) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-htz-1(gu167)_downregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG00306, GCGATCGTCCGTATACACTAAGAGGAGAGGCTATTCTACAAGTGGAACCAGAGAAATTCC, WBGene00023716 | Expr1055787 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
