WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00025906 Gene Name  Cbr-srap-1
Sequence Name  ? CBG02948 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Repeat of unknown function (DUF1174); PAN/Apple domain; and Repeat of unknown function DUF1174. Is an ortholog of C. elegans srap-1. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG02948a.1 CBG02948a.1   [unknown]
Transcript:CBG02948d.1 CBG02948d.1   [unknown]
Transcript:CBG02948c.1 CBG02948c.1   [unknown]
Transcript:CBG02948b.1 CBG02948b.1   [unknown]
 

Other

4 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG02948a CBG02948a   [unknown]
CDS:CBG02948b CBG02948b   [unknown]
CDS:CBG02948c CBG02948c   [unknown]
CDS:CBG02948d CBG02948d   [unknown]

0 RNAi Result

5 Allele

Public Name
WBVar00136014
WBVar00136015
WBVar00107910
WBVar00107912
WBVar00107911

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

3 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day9_vs_Day6_upregulated
  Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day6_vs_Day1_downregulated
  Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day9_vs_Day1_upregulated

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG02948, GAAGTTGCCACACAAATCCACGACTCTCTTCTGCCAATCAGTATTGAATGCGTCAAGTGT, WBGene00025906   Expr1054905 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region